Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250658

Morpholino Name: ywhaz MO1
Synonyms: 14-3-3zeta/delta, TTpA004p03, Xt14-3-3zeta/delta
Target mRNA: ywhaz

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTGAACCAGTTCGTTTTTATCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 25/25
genomic

MO
5' ATGGATAAAAACGAACTGGTTCAGA 3' ||||||||||||||||||||||||| 3' TACCTATTTTTGCTTGACCAAGTCT 5' 5' ATGGATAAAAATGAACTGGTCCAGA 3' ||||||||||| |||||||| |||| 3' TACCTATTTTTGCTTGACCAAGTCT 5' 5' ATGGATAAAAACGAACTGGTTCAGA 3' ||||||||||||||||||||||||| 3' TACCTATTTTTGCTTGACCAAGTCT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6S:108572341..108572365 25/25 Antisense target ywhaz.S
chr6L:132191616..132191640 23/25 Antisense target ywhaz.L
chr4L:135175869..135175893 21/25 Sense off-target LOC108714710 [provisional:il17re]
chr6L:149521167..149521191 21/25 Sense off-target cox11.L
tropicalis 10.0 Chr6:130822706..130822730 25/25 Antisense target ywhaz
Chr5:111270371..111270395 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers