Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250668

Morpholino Name: zfand6 MO1
Synonyms: XAWP1 MO2
Target mRNA: zfand6

Morpholino Type: uncategorized morpholino
Sequence: 5' TCCACCATGCAACGGGAACCGTAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:19849393..19849417 21/25 Antisense off-target LOC108712660
Publications
First: Essential role of AWP1 in neural crest specification in Xenopus., Int J Dev Biol 2013                    
Most recent:
View All Papers