Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250669

Morpholino Name: zfand6 MO2
Synonyms: XAWP1 MO1
Target mRNA: zfand6

Morpholino Type: uncategorized morpholino
Sequence: 5' TTTGTCTCCTGCGCCATAATCATCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genomic

MO
5' GCATGATTATGGCGCAAGAGACAAA 3' | |||||||||||||| |||||||| 3' CCTACTAATACCGCGTCCTCTGTTT 5' 5' GGATGATTATGGCGCAGGAGACAAA 3' ||||||||||||||||||||||||| 3' CCTACTAATACCGCGTCCTCTGTTT 5' 5' GGATGATTATGGCGCAGGAGACAAA 3' ||||||||||||||||||||||||| 3' CCTACTAATACCGCGTCCTCTGTTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:109934316..109934340 25/25 Antisense target zfand6.L
chr3S:34397287..34397311 25/25 Antisense target zfand6.S
tropicalis 10.0 Chr3:118564830..118564854 23/25 Antisense target zfand6
Publications
First: Essential role of AWP1 in neural crest specification in Xenopus., Int J Dev Biol 2013                    
Most recent:
View All Papers