Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251638

Morpholino Name: Irx2 MO3
Synonyms:
Target mRNA: irx2

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTAACCCTGAGGATAGGACATGGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genomic

MO
5' GCCATGTCCTATCCTCAGGGTTACC 3' |||||||||||||||||||||||| 3' TGGTACAGGATAGGAGTCCCAATGG 5' 5' ACCATGTCCTATCCTCAGGGTTACC 3' ||||||||||||||||||||||||| 3' TGGTACAGGATAGGAGTCCCAATGG 5' 5' GCCATGTCCTATCCTCAGGGTTACC 3' |||||||||||||||||||||||| 3' TGGTACAGGATAGGAGTCCCAATGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6L:65697983..65698007 25/25 Antisense target irx2.L
chr6S:54329692..54329716 24/25 Antisense target irx2.S
chr4S:24626699..24626723 22/25 Antisense off-target irx5.S
Scaffold116:183842..183866 21/25 Antisense off-target irx5.L
tropicalis 10.0 Chr6:67766825..67766849 24/25 Antisense target irx2
Chr4:42285214..42285238 22/25 Antisense off-target irx5
Chr3:21076451..21076475 21/25 Sense off-target slc6a7
Publications
First: The prepattern transcription factor Irx3 directs nephron segment identity., Genes Dev 2007                  
Most recent:
View All Papers