Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251667

Morpholino Name: fermt2 MO1
Synonyms:
Target mRNA: fermt2

Morpholino Type: uncategorized morpholino
Sequence: 5' GCATCCGTATACCATCCAAAGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' ATGGCTTTGGATGGTATAAGGATGC 3' |||||||||||||||||| |||||| 3' TACCGAAACCTACCATATGCCTACG 5' 5' ATGGCTTTGGATGGTATACGGATGC 3' ||||||||||||||||||||||||| 3' TACCGAAACCTACCATATGCCTACG 5' 5' ATGGCTTTGGATGGTATACGGATGC 3' ||||||||||||||||||||||||| 3' TACCGAAACCTACCATATGCCTACG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8L:70894553..70894577 25/25 Antisense target fermt2.L
chr8S:14079980..14080004 25/25 Antisense target fermt2.S
chr9_10S:48146207..48146231 22/25 Antisense off-target vil1.S
tropicalis 10.0 Chr8:94647721..94647745 24/25 Antisense target fermt2
Publications
First: Diverse functions of kindlin/fermitin proteins during embryonic development in Xenopus laevis., Mech Dev 2014                  
Most recent:
View All Papers