Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251703

Morpholino Name: lpar2 MO2
Synonyms:
Target mRNA: lpar2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' ATAAAAGCACTGATTCATCTTGAGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 22/25 25/25
genomic

MO
5' GCTCAAGATGAGTCAGTGCTTTTAT 3' |||||||||| ||||||||||||| 3' TGAGTTCTACTTAGTCACGAAAATA 5' 5' CATCAAGATGAGTCAGTGCTTTTAT 3' ||||||||| ||||||||||||| 3' TGAGTTCTACTTAGTCACGAAAATA 5' 5' ACTCAAGATGAATCAGTGCTTTTAT 3' ||||||||||||||||||||||||| 3' TGAGTTCTACTTAGTCACGAAAATA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold79:62340..62364 25/25 Antisense target lpar2.S
chr3L:128660354..128660378 22/25 Antisense target lpar2.L
chr9_10S:81355875..81355899 22/25 unknown
chr3L:119963775..119963799 21/25 unknown
chr4L:92747019..92747043 21/25 unknown
tropicalis 10.0 Chr3:135181477..135181501 23/25 Antisense target lpar2
Chr1:139625360..139625384 21/25 Antisense off-target rnf212b
Chr10:3124768..3124792 21/25 Antisense off-target LOC100495442
Chr2:89048818..89048842 22/25 unknown
Chr1:170627775..170627799 21/25 unknown
Publications
First: In vivo collective cell migration requires an LPAR2-dependent increase in tissue fluidity., J Cell Biol 2014                                  
Most recent:
View All Papers