Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251713

Morpholino Name: hpse2 MO1
Synonyms:
Target mRNA: hpse2

Morpholino Type: splice blocking morpholino
Sequence: 5' TTGGAACTGCATGTAAAGAGAGACA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGTCTCTCTTTACATGCAGTTCCAA 3' ||||||||||||||||||||||||| 3' ACAGAGAGAAATGTACGTCAAGGTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 Scaffold23:3807393..3807417 21/25 Sense off-target parg.L
chr1L:51931372..51931396 21/25 unknown
chr4L:118674955..118674979 21/25 unknown
tropicalis 10.0 Chr7:35118694..35118718 25/25 Antisense target hpse2
Chr1:76630368..76630392 21/25 Antisense off-target LOC100485437
Publications
First: Heparanase 2, mutated in urofacial syndrome, mediates peripheral neural development in Xenopus., Hum Mol Genet 2014                                
Most recent:
View All Papers