Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251721

Morpholino Name: ventx1.1 MO3
Synonyms:
Target mRNA: ventx1.1

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CAATAGAGAATCCCTGTTGAACCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGGTTCAACAGGGATTCTCTATTG 3' ||||||||||||||||||||||||| 3' TACCAAGTTGTCCCTAAGAGATAAC 5' 5' ATGGTTCAACAGGGATTCTCTATTG 3' ||||||||||||||||||||||||| 3' TACCAAGTTGTCCCTAAGAGATAAC 5' 5' ATGGTTCAACAGGGATTCTCTATTG 3' ||||||||||||||||||||||||| 3' TACCAAGTTGTCCCTAAGAGATAAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7L:21843841..21843865 25/25 Antisense target ventx1.1.L
chr7S:16923452..16923476 25/25 Antisense target ventx1.1.S
chr7L:21801164..21801188 25/25 Antisense off-target ventx1.2.L
chr7L:21843841..21843865 25/25 Sense off-target LOC108696137
chr7S:16883681..16883705 25/25 Antisense off-target ventx1.2.S
tropicalis 10.0 Chr7:26893165..26893189 25/25 Antisense target ventx1.1
Chr7:26856614..26856638 25/25 Antisense off-target ventx1.2
Chr7:127052213..127052237 21/25 Sense off-target MGC147188
Publications
First: A study of mesoderm patterning through the analysis of the regulation of Xmyf-5 expression., Development 2002          
Most recent:
View All Papers