Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251722

Morpholino Name: ventx2.1 MO4
Synonyms:
Target mRNA: ventx2.1

Morpholino Type: uncategorized morpholino
Sequence: 5' TTCCTGTAGTAGTCCTTGTGTTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 21/25 22/25
genomic

MO
5' ATGAACACAAGGACTACTACAGGAA 3' ||||||||||||||||||||||||| 3' TACTTGTGTTCCTGATGATGTCCTT 5' 5' AAGAACACAAGGACTAATACAGACA 3' | |||||||||||||| ||||| | 3' TACTTGTGTTCCTGATGATGTCCTT 5' 5' ATGAACACAAGGACTAATACAGACA 3' |||||||||||||||| ||||| | 3' TACTTGTGTTCCTGATGATGTCCTT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7S:16933901..16933925 22/25 Antisense target ventx2.1.S
chr7L:21859843..21859867 21/25 Antisense target ventx2.1.L
chr7S:16908613..16908637 22/25 Antisense off-target ventx2.2.S
chr7L:21829663..21829687 21/25 Antisense off-target ventx2.2.L
chr1S:103055596..103055620 21/25 unknown
tropicalis 10.0 Chr7:26905804..26905828 25/25 Antisense target ventx2.1
Chr7:26877264..26877288 25/25 Antisense off-target ventx2.2
Publications
First: A study of mesoderm patterning through the analysis of the regulation of Xmyf-5 expression., Development 2002          
Most recent: Functional specificity of the Xenopus T-domain protein Brachyury is conferred by its ability to interact with Smad1., Dev Cell 2005    
View All Papers