Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251730

Morpholino Name: sec23ip MO1
Synonyms:
Target mRNA: sec23ip

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CCCCGTTCGGTACCTTCCCCGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' ATGGCGGGGAAGGTACCTAACGGGG 3' ||||||||||||||||| ||||||| 3' TACCGCCCCTTCCATGGCTTGCCCC 5' 5' ATGGCGGGGAAGGTACCGAACGGGG 3' ||||||||||||||||||||||||| 3' TACCGCCCCTTCCATGGCTTGCCCC 5' 5' ATGGCGGGGAAGGTACCGAACGGGG 3' ||||||||||||||||||||||||| 3' TACCGCCCCTTCCATGGCTTGCCCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:4904027..4904051 25/25 Antisense target sec23ip.L
Chr7S:3478958..3478982 25/25 Antisense target sec23ip.S
tropicalis 10.0 Chr7:6241474..6241498 24/25 Antisense target sec23ip
Chr3:140148298..140148322 21/25 unknown
Publications
First: Systematic discovery of nonobvious human disease models through orthologous phenotypes., Proc Natl Acad Sci U S A 2010                                      
Most recent:
View All Papers