Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251731

Morpholino Name: pou5f3.1 MO4
Synonyms:
Target mRNA: pou5f3.1

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CCTGTTGGTTATACATGGTCGGCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GAGCCGACCATGTATAACCAACAGG 3' ||||||||||||||||||||||||| 3' CTCGGCTGGTACATATTGGTTGTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 10.0 Chr8:3301469..3301493 25/25 Antisense target pou5f3.1
Publications
First: Genome-wide view of TGFβ/Foxh1 regulation of the early mesendoderm program., Development 2014                                    
Most recent:
View All Papers