Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251908

Morpholino Name: cnrip1 MO1
Synonyms:
Target mRNA: cnrip1

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GATCTCCCCCATTTCTTGCGGCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/23 23/23
genomic

MO
5' GGCTGCAAGAAATGGGGGAGATT 3' ||| |||||||||||||||||| 3' CCGGCGTTCTTTACCCCCTCTAG 5' 5' GGCCGCAAGAAATGGGGGAGATC 3' ||||||||||||||||||||||| 3' CCGGCGTTCTTTACCCCCTCTAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:29084628..29084650 23/23 Antisense target cnrip1.L
Chr2L:8982554..8982576 19/23 Sense off-target LOC121399810
tropicalis 10.0 Chr5:30447640..30447662 21/23 Antisense target cnrip1
Chr3:4592789..4592811 19/23 Sense off-target scube1
Publications
First: cnrip1 is a regulator of eye and neural development in Xenopus laevis., Genes Cells 2015                            
Most recent:
View All Papers