Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251909

Morpholino Name: cnr1 MO1
Synonyms:
Target mRNA: cnr1

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GGCCATCCAGAATTGACTTCATTAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GTAATGAAGTCAATTCTGGATGGCC 3' ||||||||||||||||||||||||| 3' CATTACTTCAGTTAAGACCTACCGG 5' 5' GTAATGAAGTCAATTCTGGATGGCC 3' ||||||||||||||||||||||||| 3' CATTACTTCAGTTAAGACCTACCGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:89922117..89922141 25/25 Antisense target cnr1.L
Chr5S:73767505..73767529 25/25 Antisense target cnr1.S
Chr8S:67468679..67468703 22/25 Sense off-target LOC108700132
tropicalis 10.0 Chr10:43860280..43860304 21/25 Antisense off-target acsf2
Chr6:58272092..58272116 21/25 Antisense off-target sugct
Chr6:79825533..79825557 21/25 unknown
Publications
First: cnrip1 is a regulator of eye and neural development in Xenopus laevis., Genes Cells 2015                            
Most recent:
View All Papers