Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310768

Morpholino Name: tbxt MO3
Synonyms: TGas116l23, Xbra MO2, Xtbra.2
Target mRNA: tbxt

Morpholino Type: translation blocking morpholino
Sequence: 5' GGCTTCCAAGCGCACACACTGGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/23
genomic

MO
5' CCCAGTGTGTGCGCTTGGAAGCC 3' ||||||||||||||||||||||| 3' GGGTCACACACGCGAACCTTCGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8L:13523907..13523929 19/23 Sense off-target mid2.L
chr8S:69867603..69867625 19/23 unknown
chr9_10L:25599031..25599053 19/23 unknown
tropicalis 10.0 Chr5:55135471..55135493 23/23 Antisense target tbxt
Chr6:49880565..49880587 21/23 Antisense off-target osbpl10
Chr8:107311147..107311169 20/23 unknown
Chr3:142553241..142553263 19/23 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: The Spatiotemporal Control of Zygotic Genome Activation., iScience 2019                            
View All Papers