Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310770

Morpholino Name: tbxt.2 MO3
Synonyms: Bra3, TNeu061i04, Xbra3 MO2, XtBra3
Target mRNA: tbxt.2

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTGTGCCTGTGCTCATTGTATTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 22/25
genomic

MO
5' CAATACAATGAGCACAGGCACAGCT 3' ||||||||||||||||||||||||| 3' GTTATGTTACTCGTGTCCGTGTCGA 5' 5' CAATACTATGAGTACAGGCACAGCT 3' |||||| ||||| |||||||||||| 3' GTTATGTTACTCGTGTCCGTGTCGA 5' 5' CAATACAATGAGCACAAACACATCT 3' |||||||||||||||| |||| || 3' GTTATGTTACTCGTGTCCGTGTCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:56140329..56140353 23/25 Antisense target tbxt.2.L
chr5S:46620503..46620527 22/25 Antisense target tbxt.2.S
chr5S:22060844..22060868 22/25 Sense off-target LOC108717536 [provisional:gch1]
chr5S:54230316..54230340 21/25 unknown
tropicalis 10.0 Chr5:55098113..55098137 25/25 Antisense target tbxt.2
Chr8:11430758..11430782 21/25 Sense off-target tsc1
Chr1:171233598..171233622 21/25 unknown
Chr7:64613500..64613524 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: The Spatiotemporal Control of Zygotic Genome Activation., iScience 2019                            
View All Papers