Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310775

Morpholino Name: lef1 MO5
Synonyms: XtLEF1 MOex8
Target mRNA: lef1

Morpholino Type: uncategorized morpholino
Sequence: 5' TCCTACTACTTACCCTTCTACCCAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25 22/25
genomic

MO
5' CTGGGTAGAAGGGTAAGTAGTAGGA 3' ||||||||||||||||||||||||| 3' GACCCATCTTCCCATTCATCATCCT 5' 5' CTGGGAAGGAGGGTAAGTAGTAGAA 3' ||||| || |||||||||||||| | 3' GACCCATCTTCCCATTCATCATCCT 5' 5' CTGGGCAGAAGGGTAAGTAGTGGAA 3' ||||| ||||||||||||||| | | 3' GACCCATCTTCCCATTCATCATCCT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:59923799..59923823 22/25 Antisense target lef1.L
chr1S:54912946..54912970 22/25 Antisense target lef1.S
chr4S:100124107..100124131 21/25 Antisense off-target LOC108715031
tropicalis 10.0 Chr1:66988741..66988765 25/25 Antisense target lef1
Chr4:143554263..143554287 21/25 Antisense off-target lrig1
Chr8:131466727..131466751 21/25 Antisense off-target nek2
Chr8:5307150..5307174 21/25 unknown
Publications
First: Design and use of transgenic reporter strains for detecting activity of signaling pathways in Xenopus., Methods 2014  
Most recent:
View All Papers