Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311051

Morpholino Name: inhba MO1
Synonyms: MOBa, actBa e1i1
Target mRNA: inhba

Morpholino Type: splice blocking morpholino (E1-I1)
Sequence: 5' TTACTGTCTCACAAACTCACCTGAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 22/25
genomic

MO
5' ATCAGGTGAGTTTGTGAGACAGTAA 3' ||||||||||||||||||||||||| 3' TAGTCCACTCAAACACTCTGTCATT 5' 5' ATCAGGTGAGTTTCTGAGACACTAA 3' ||||||||||||| ||||||| ||| 3' TAGTCCACTCAAACACTCTGTCATT 5' 5' ATCAGGTGAGTTTCTGAGACACTTA 3' ||||||||||||| ||||||| | | 3' TAGTCCACTCAAACACTCTGTCATT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6L:56018215..56018239 23/25 Antisense target inhba.L
chr6S:49453096..49453120 22/25 Antisense target inhba.S
chr5L:34568991..34569015 22/25 unknown
tropicalis 10.0 Chr6:57855710..57855734 25/25 Antisense target inhba
Publications
First: Activin ligands are required for the re-activation of Smad2 signalling after neurulation and vascular development in Xenopus tropicalis., Int J Dev Biol 2014              
Most recent:
View All Papers