Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311052

Morpholino Name: inhba MO2
Synonyms: MoBaATG, actBa atg
Target mRNA: inhba

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CTCCTTTCAGCAAGCGTGCAGGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genomic

MO
5' ATGCCTGCACGCTTGCTGAAAGGAG 3' ||||||||||||||||||||||||| 3' TACGGACGTGCGAACGACTTTCCTC 5' 5' ATGCCTGCACACTTGCTGAAAGGAG 3' |||||||||| |||||||||||||| 3' TACGGACGTGCGAACGACTTTCCTC 5' 5' ATGCCTGCACGCTTGCTGAAAGGAG 3' ||||||||||||||||||||||||| 3' TACGGACGTGCGAACGACTTTCCTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6S:49452713..49452737 25/25 Antisense target inhba.S
chr6L:56017832..56017856 24/25 Antisense target inhba.L
tropicalis 10.0 Chr6:57855327..57855351 25/25 Antisense target inhba
Chr3:24137054..24137078 21/25 Sense off-target gabrb2
Chr3:120868251..120868275 21/25 unknown
Publications
First: Activin ligands are required for the re-activation of Smad2 signalling after neurulation and vascular development in Xenopus tropicalis., Int J Dev Biol 2014              
Most recent:
View All Papers