Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311102

Morpholino Name: Tubz1 MO2
Synonyms: Zeta MO2
Target mRNA: tubz1

Morpholino Type: splice blocking morpholino
Sequence: 5' AATTAGAAGGAACCACACACCCTCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGAGGGTGTGTGGTTCCTTCTAATT 3' ||||||||||||||||||||||||| 3' TCTCCCACACACCAAGGAAGATTAA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:6453727..6453751 25/25 Antisense target tubz1.L
Chr2S:131060156..131060180 21/25 Sense off-target lrp1.S
Chr9_10S:47870479..47870503 22/25 unknown
Publications
First: Zeta-Tubulin Is a Member of a Conserved Tubulin Module and Is a Component of the Centriolar Basal Foot in Multiciliated Cells., Curr Biol 2015                
Most recent:
View All Papers