Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311156

Morpholino Name: wnt11b MO4
Synonyms:
Target mRNA: wnt11b

Morpholino Type: uncategorized morpholino
Sequence: 5' CCAGTGACGGTCGGAGCCATTGGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: Sebox regulates mesoderm formation in early amphibian embryos., Dev Dyn 2015                
Most recent:
View All Papers