Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311194

Morpholino Name: inhbb MO7
Synonyms: MOBetaB, act-beta-b, actbb
Target mRNA: inhbb

Morpholino Type: uncategorized morpholino
Sequence: 5' CCACAAGCAGTAACAGGAGAGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' ATGGCTCTCCTGTTACTGCTTGTGG 3' ||||||||||||||||||||||||| 3' TACCGAGAGGACAATGACGAACACC 5' 5' ATGGCTCTCCTGTTACTGCCTCTGC 3' ||||||||||||||||||| | || 3' TACCGAGAGGACAATGACGAACACC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:46347672..46347696 22/25 Antisense target inhbb.L
chr7L:22089869..22089893 21/25 Sense off-target adgra1.L
tropicalis 10.0 Chr9:89123127..89123151 25/25 Antisense target inhbb
Chr9:89123127..89123151 25/25 Sense off-target Xetrov107063276m.g
Chr7:36377670..36377694 21/25 Antisense off-target pank1
Publications
First: Activin ligands are required for the re-activation of Smad2 signalling after neurulation and vascular development in Xenopus tropicalis., Int J Dev Biol 2014              
Most recent:
View All Papers