Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311232

Morpholino Name: pinx1 MO1
Synonyms: 67-11-3, TEgg056i10, Xt67-11-3
Target mRNA: pinx1

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGGTCCCGGAGCTGGAAGCCCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2L:20911480..20911504 21/25 unknown
tropicalis 10.0 Chr4:148624714..148624738 23/25 Sense off-target dnah12
Chr4:153775536..153775560 21/25 Sense off-target LOC101733834
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers