Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311233

Morpholino Name: chn2 MO1
Synonyms: Chimerin 1, TEgg020c18, Xta2Chimerin, chn1 MO2
Target mRNA: chn2

Morpholino Type: uncategorized morpholino
Sequence: 5' ATTGTCGAATAAAGTGAGAGCCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 21/25
genomic

MO
5' CATGGCTCTCACTTTATTCGGTGAG 3' |||||||||||||||||||| | 3' GTACCGAGAGTGAAATAAGCTGTTA 5' 5' CATGGCTCTCACTTTATTCGGTGAG 3' |||||||||||||||||||| | 3' GTACCGAGAGTGAAATAAGCTGTTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:68594661..68594685 21/25 Antisense target chn2.L
chr9_10S:62802294..62802318 21/25 Antisense target chn2.S
Scaffold64:781599..781623 22/25 unknown
chr1S:21295735..21295759 21/25 unknown
chr2S:26744443..26744467 21/25 unknown
tropicalis 10.0 Chr9:64344290..64344314 21/25 Antisense off-target chn1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers