Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311236

Morpholino Name: actr6 MO1
Synonyms: TEgg077g12, XtARP6
Target mRNA: actr6

Morpholino Type: uncategorized morpholino
Sequence: 5' GTTGTCCAGAACAAGTGTGGTCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' GATGACCACACTTGTTCTGGACAAC 3' ||||||||||||||||||||||||| 3' CTACTGGTGTGAACAAGACCTGTTG 5' 5' GATGGCTACACTTGTTCTGGATAAC 3' |||| | |||||||||||||| ||| 3' CTACTGGTGTGAACAAGACCTGTTG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:43076119..43076143 22/25 Antisense target actr6.L
chr7L:112312254..112312278 21/25 unknown
chr7S:12559166..12559190 21/25 unknown
tropicalis 10.0 Chr3:50226395..50226419 25/25 Antisense target actr6
Chr10:23858332..23858356 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers