Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311239

Morpholino Name: prdm1 MO1
Synonyms: Blimp1, TGas049g17, XtBlimp1
Target mRNA: prdm1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATTCCTTCCATATCCATTTTCATTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' CAATGAAAATGGATATGGAAGGAAT 3' ||||||||||||||||||||||||| 3' GTTACTTTTACCTATACCTTCCTTA 5' 5' CAATGAAAATGGATATGGAAGGAAT 3' ||||||||||||||||||||||||| 3' GTTACTTTTACCTATACCTTCCTTA 5' 5' CAATGAAAATGGATATGGAAGGAAT 3' ||||||||||||||||||||||||| 3' GTTACTTTTACCTATACCTTCCTTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:80861202..80861226 25/25 Antisense target prdm1.L
chr5S:62030098..62030122 25/25 Antisense target prdm1.S
chr1S:145271034..145271058 21/25 Antisense off-target epb41l4a.S
chr5S:87061182..87061206 21/25 Antisense off-target LOC108718075 [provisional:dlg1]
chr8S:31535207..31535231 21/25 Sense off-target ralgds.S
chr5S:117763685..117763709 22/25 unknown
Scaffold17081:49..73 21/25 unknown
chr3S:52016318..52016342 21/25 unknown
tropicalis 10.0 Chr5:79519093..79519117 25/25 Antisense target prdm1
Chr5:79519093..79519117 25/25 Sense off-target atg5
Chr1:32216012..32216036 21/25 Sense off-target stim2
Chr1:48962527..48962551 21/25 Antisense off-target Xetrov107001511m.g
Chr1:48962527..48962551 21/25 Antisense off-target galntl6
Chr4:30974838..30974862 21/25 Antisense off-target LOC100492951
Chr2:109536366..109536390 21/25 Antisense off-target slc5a7
Chr3:142045683..142045707 21/25 Sense off-target LOC100170611
Chr8:12317323..12317347 22/25 unknown
Chr10:17979645..17979669 21/25 unknown
Chr6:83385666..83385690 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers