Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311245

Morpholino Name: tbxt MO4
Synonyms: TGas116l23, Xtbra, xbra
Target mRNA: tbxt

Morpholino Type: uncategorized morpholino
Sequence: 5' TGGCACTTACACTCATTCCTCAAGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TCTTGAGGAATGAGTGTAAGTGCCA 3' ||||||||||||||||||||||||| 3' AGAACTCCTTACTCACATTCACGGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr5:55135442..55135466 25/25 Antisense target tbxt
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers