Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311246

Morpholino Name: zmynd11 MO1
Synonyms: CX843311, XtBS69
Target mRNA: zmynd11

Morpholino Type: uncategorized morpholino
Sequence: 5' CAATCTGTTTCTGGTTGCGGATTAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' GTAATCCGCAACCAGAAACAGATTG 3' ||||||||||||||||||||||||| 3' CATTAGGCGTTGGTCTTTGTCTAAC 5' 5' GTCATCCGCAACCAGAAACAGATTG 3' || |||||||||||||||||||||| 3' CATTAGGCGTTGGTCTTTGTCTAAC 5' 5' GTCATCCGCAACCAGAAACAGATTG 3' || |||||||||||||||||||||| 3' CATTAGGCGTTGGTCTTTGTCTAAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6L:15067580..15067604 24/25 Antisense target zmynd11.L
chr6S:12308288..12308312 24/25 Antisense target zmynd11.S
Scaffold24:158677..158701 21/25 Antisense off-target appl1.L
Scaffold40:1659011..1659035 21/25 Antisense off-target appl1.S
chr8L:95001901..95001925 22/25 unknown
chr7S:54301407..54301431 21/25 unknown
tropicalis 10.0 Chr6:18839079..18839103 25/25 Antisense target zmynd11
Chr4:148652810..148652834 21/25 Antisense off-target appl1
Chr5:86919870..86919894 21/25 Sense off-target orc3
Chr6:92658901..92658925 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers