Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311247

Morpholino Name: zmynd11 MO2
Synonyms: CX843311, XtBS69.2
Target mRNA: zmynd11

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGCCATGCACTCGCGTCATGTAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 23/25
genomic

MO
5' GTACATGACGCGAGTGCATGGCATG 3' ||||||||||||||||||||||||| 3' CATGTACTGCGCTCACGTACCGTAC 5' 5' GTACATGACGCGAGTGCATGGGATG 3' ||||||||||||||||||||| ||| 3' CATGTACTGCGCTCACGTACCGTAC 5' 5' GTACATGACGCGAGTGCATGGGATA 3' ||||||||||||||||||||| || 3' CATGTACTGCGCTCACGTACCGTAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6L:15073886..15073910 24/25 Antisense target zmynd11.L
chr6S:12312140..12312164 23/25 Antisense target zmynd11.S
tropicalis 10.0 Chr6:18841921..18841945 25/25 Antisense target zmynd11
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers