Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311251

Morpholino Name: dynll1 MO1
Synonyms: TGas050a15, XtcD2LC, cD2LC
Target mRNA: dynll1

Morpholino Type: uncategorized morpholino
Sequence: 5' GATCACAGCTTTTCTCTCAGACATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' CATGTCTGAGAGAAAAGCTGTGATC 3' ||||||||||||||||||||||||| 3' GTACAGACTCTCTTTTCGACACTAG 5' 5' CATGTCTGAGAGGAAAGCTGTGATC 3' |||||||||||| |||||||||||| 3' GTACAGACTCTCTTTTCGACACTAG 5' 5' CATGTCTGAGAGGAAAGCTGTGATC 3' |||||||||||| |||||||||||| 3' GTACAGACTCTCTTTTCGACACTAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:151390697..151390721 24/25 Antisense target dynll1.L
chr1S:125084487..125084511 24/25 Antisense target dynll1.S
chr9_10L:713421..713445 21/25 Antisense off-target LOC108701751 [provisional:znf385c]
tropicalis 10.0 Chr1:151769521..151769545 25/25 Antisense target dynll1
Chr5:812658..812682 21/25 Antisense off-target ttbk1
Chr6:136403996..136404020 21/25 unknown
Chr8:109508475..109508499 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers