Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311257

Morpholino Name: cdx1 MO3
Synonyms: CAD2, Cdx2, TNeu087f10, Xtcdx-2
Target mRNA: cdx1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCCAAAAGATAACCCACGTACATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GATGTACGTGGGTTATCTTTTGGAT 3' ||||||||||||||||||||||||| 3' CTACATGCACCCAATAGAAAACCTA 5' 5' GATGTACGTGGGTTATCTTTTGGAT 3' ||||||||||||||||||||||||| 3' CTACATGCACCCAATAGAAAACCTA 5' 5' GATGTACGTGGGTTATCTTTTGGAT 3' ||||||||||||||||||||||||| 3' CTACATGCACCCAATAGAAAACCTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:6998285..6998309 25/25 Antisense target cdx1.L
chr3S:15894496..15894520 25/25 Antisense target cdx1.S
chr6L:72534751..72534775 21/25 Sense off-target LOC108718513 [provisional:dnah5]
chr8L:98725956..98725980 21/25 Antisense off-target zfyve26.L
chr8L:54046064..54046088 21/25 unknown
tropicalis 10.0 Chr3:21149802..21149826 25/25 Antisense target cdx1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: Overlapping functions of Cdx1, Cdx2, and Cdx4 in the development of the amphibian Xenopus tropicalis., Dev Dyn 2009                                  
View All Papers