Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311259

Morpholino Name: suv420h1 MO2
Synonyms: SET8, TTpA011k01, XtCGI-85
Target mRNA: kmt5b

Morpholino Type: uncategorized morpholino
Sequence: 5' TGGATTCGCCCAACCACTTCATGCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genomic

MO
5' GGCATGAAGTGGTTGGGCGAATCCA 3' ||||||||||||||||||||||||| 3' CCGTACTTCACCAACCCGCTTAGGT 5' 5' GGAATGAAGTGGTTGGGCGAATCCA 3' || |||||||||||||||||||||| 3' CCGTACTTCACCAACCCGCTTAGGT 5' 5' GGCATGAAGTGGTTGGGCGAATCCA 3' ||||||||||||||||||||||||| 3' CCGTACTTCACCAACCCGCTTAGGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4S:1401509..1401533 25/25 Antisense target kmt5b.S
chr4L:27069395..27069419 24/25 Antisense target kmt5b.L
chr9_10L:38623135..38623159 21/25 Antisense off-target ogfod3.L
chr6L:76165523..76165547 21/25 unknown
chr6S:104353469..104353493 21/25 unknown
tropicalis 10.0 Chr4:37337871..37337895 25/25 Antisense target kmt5b
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers