Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311262

Morpholino Name: cpsf1 MO1
Synonyms: CPSF1, TNeu108p17, Xtcpsf160kDa
Target mRNA: cpsf1

Morpholino Type: uncategorized morpholino
Sequence: 5' CGCTTGTCGGTACACAGCGTACATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 23/25
genomic

MO
5' GATGTATGCTGTGTACCGACAAGCG 3' |||||| |||||||||||||||||| 3' CTACATGCGACACATGGCTGTTCGC 5' 5' CATGTACGCCGTGTACCGACAAGCG 3' |||||||| ||||||||||||||| 3' CTACATGCGACACATGGCTGTTCGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6L:154722655..154722679 23/25 Antisense target cpsf1.L
chr6S:128138878..128138902 23/25 Antisense off-target LOC108719780 [provisional:cpsf1]
tropicalis 10.0 Chr6:153965930..153965954 24/25 Antisense target cpsf1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers