Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311263

Morpholino Name: cpsf4 MO1
Synonyms: TGas053l04, Xtcpsf30kDa
Target mRNA: cpsf4

Morpholino Type: uncategorized morpholino
Sequence: 5' CCACACAAGCAATTAACTCCTGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' ATGCAGGAGTTAATTGCTTGTGTGG 3' ||||||||||||||||||||||||| 3' TACGTCCTCAATTAACGAACACACC 5' 5' ATGCAGGAGTTAATCGCTTGTGTGG 3' |||||||||||||| |||||||||| 3' TACGTCCTCAATTAACGAACACACC 5' 5' ATGCAGGAGTTAATCGCTTGTGTGG 3' |||||||||||||| |||||||||| 3' TACGTCCTCAATTAACGAACACACC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:85052864..85052888 24/25 Antisense target cpsf4.L
chr9_10S:76557309..76557333 24/25 Antisense target cpsf4.S
chr2L:118991815..118991839 21/25 Sense off-target LOC108708470 [provisional:fgf14]
chr6S:35858801..35858825 21/25 Antisense off-target plcl2.S
chr8L:60401808..60401832 21/25 Sense off-target ngb.L
chr8S:204254..204278 21/25 Antisense off-target plxna3.S
chr9_10S:46861971..46861995 21/25 Antisense off-target speg.S
chr9_10S:46861971..46861995 21/25 Antisense off-target LOC108702928 [provisional:speg]
chr2S:93652281..93652305 22/25 unknown
chr3L:61816444..61816468 21/25 unknown
chr8L:115692506..115692530 21/25 unknown
chr8L:115710832..115710856 21/25 unknown
tropicalis 10.0 Chr9:47263917..47263941 25/25 Antisense target cpsf4
Chr9:47263917..47263941 25/25 Sense off-target ptcd1
Chr6:16188207..16188231 22/25 Sense off-target paxip1
Chr4:121799859..121799883 21/25 Sense off-target LOC100488097
Chr4:121799859..121799883 21/25 Antisense off-target rangap1
Chr4:32677490..32677514 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers