Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311264

Morpholino Name: cpsf3 MO1
Synonyms: TGas065k24, Xtcpsf73kDa
Target mRNA: cpsf3

Morpholino Type: uncategorized morpholino
Sequence: 5' CTCCGCTTTCCTTTTCACAGACATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' CATGTCTGTGAAAAGGAAAGCGGAG 3' ||||||||||||||||||||||||| 3' GTACAGACACTTTTCCTTTCGCCTC 5' 5' CATGTCTGTGAAAAGGAAAGCAGAG 3' ||||||||||||||||||||| ||| 3' GTACAGACACTTTTCCTTTCGCCTC 5' 5' CATGTCTGTGAAAAGGAAAGCAGAG 3' ||||||||||||||||||||| ||| 3' GTACAGACACTTTTCCTTTCGCCTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:137549374..137549398 24/25 Antisense target cpsf3.L
chr5S:118599353..118599377 24/25 Antisense target cpsf3.S
chr3L:22122732..22122756 22/25 unknown
chr6L:39533079..39533103 21/25 unknown
tropicalis 10.0 Chr5:137804288..137804312 25/25 Antisense target cpsf3
Chr5:137804288..137804312 25/25 Sense off-target itgb1bp1
Chr1:210375943..210375967 23/25 Sense off-target celf4
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers