Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311265

Morpholino Name: dync1li1 MO2
Synonyms: TGas061b15, XtD1LIC, cD1LIC
Target mRNA: dync1li1

Morpholino Type: uncategorized morpholino
Sequence: 5' CGGTACGCCCGGTTGCCATCCTCTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 23/25
genomic

MO
5' TAGAGGATGGCAACCGGGCGTACCG 3' ||||||||||||||||||||||||| 3' ATCTCCTACCGTTGGCCCGCATGGC 5' 5' TAGAGGATGGCATCCGGACGTACCG 3' |||||||||||| |||| ||||||| 3' ATCTCCTACCGTTGGCCCGCATGGC 5' 5' TAGAGGATGGCATCCGGGCGTAGCG 3' |||||||||||| ||||||||| || 3' ATCTCCTACCGTTGGCCCGCATGGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6L:48234914..48234938 23/25 Antisense target dync1li1.L
chr6S:41775743..41775767 23/25 Antisense target dync1li1.S
chr7S:73635330..73635354 21/25 unknown
tropicalis 10.0 Chr6:50184794..50184818 25/25 Antisense target dync1li1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers