Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311266

Morpholino Name: dync1li1 MO3
Synonyms: TGas061b15, XtD1LIC.2, cD1LIC
Target mRNA: dync1li1

Morpholino Type: uncategorized morpholino
Sequence: 5' CTCTTCTGGTGAGCAGGAGGATGAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genomic

MO
5' ATCATCCTCCTGCTCACCAGAAGAG 3' ||||||||||||||||||||||||| 3' TAGTAGGAGGACGAGTGGTCTTCTC 5' 5' ATCATCCTCTTGCTCACCAGAAGAG 3' ||||||||| ||||||||||||||| 3' TAGTAGGAGGACGAGTGGTCTTCTC 5' 5' ATCATCCTCCTGCTCACCAGAAGAG 3' ||||||||||||||||||||||||| 3' TAGTAGGAGGACGAGTGGTCTTCTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6S:41775777..41775801 25/25 Antisense target dync1li1.S
chr6L:48234948..48234972 24/25 Antisense target dync1li1.L
tropicalis 10.0 Chr6:50184828..50184852 25/25 Antisense target dync1li1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers