Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311267

Morpholino Name: dync2li1 MO1
Synonyms: D2LIC, TNeu059o03, XtD2LIC
Target mRNA: dync2li1

Morpholino Type: uncategorized morpholino
Sequence: 5' GGCATCGCCTTCAGCCCTGAGCGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24
genomic

MO
5' GCGCTCAGGGCTGAAGGCGATGCC 3' |||||||||||||||||||||||| 3' CGCGAGTCCCGACTTCCGCTACGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1S:34092292..34092315 20/24 Antisense off-target wwc2.S
chr6L:15138729..15138752 20/24 Antisense off-target LOC108718748 [provisional:dip2c]
chr8S:47261672..47261695 20/24 unknown
tropicalis 10.0 Chr5:18421153..18421176 24/24 Antisense target dync2li1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers