Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311268

Morpholino Name: dync2li1 MO2
Synonyms: D2LIC, TNeu059o03, XtD2LIC.2
Target mRNA: dync2li1

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTACAGACTCACAAGAAACCAAAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:38849005..38849029 21/25 Antisense off-target ralgapa2.L
tropicalis 10.0 Chr1:5768854..5768878 21/25 Antisense off-target LOC116408543
Chr6:105933766..105933790 21/25 Antisense off-target arhgap28
Chr7:102062030..102062054 21/25 Antisense off-target prdm16
Chr9:58138587..58138611 21/25 Antisense off-target spag16
Chr9:58138587..58138611 21/25 Antisense off-target Xetrov107062141m.g
Chr5:163798482..163798506 21/25 unknown
Chr7:656483..656507 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers