Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311272

Morpholino Name: dlg1 MO1
Synonyms: TEgg018e06, XtDlgh1, dlgh1
Target mRNA: dlg1

Morpholino Type: uncategorized morpholino
Sequence: 5' GTATCTTGCTTCCTGACAGGCATGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' CCATGCCTGTCAGGAAGCAAGGTGT 3' ||||||||||||||||||||| | 3' GGTACGGACAGTCCTTCGTTCTATG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:102393500..102393524 22/25 Antisense off-target LOC108716985 [provisional:dlg1]
chr5L:102393500..102393524 22/25 Sense off-target Xelaev18027515m
chr2L:124062652..124062676 21/25 unknown
tropicalis 10.0 Chr5:106235921..106235945 22/25 Antisense target dlg1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers