Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311273

Morpholino Name: cdk2ap2 MO1
Synonyms: DOC-1, TGas028g07, XtDOC-1
Target mRNA: cdk2ap2

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGGGCTTATACGACATGCTTTAAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GTTAAAGCATGTCGTATAAGCCCAT 3' ||||||||||||||||||||||||| 3' CAATTTCGTACAGCATATTCGGGTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr7:59557775..59557799 25/25 Antisense target cdk2ap2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers