Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311274

Morpholino Name: dmd.2 MO1
Synonyms: Dp427p1, TGas086e13, XtdysDp427p1
Target mRNA: dmd.2

Morpholino Type: uncategorized morpholino
Sequence: 5' TTTCATTGTGTCCGGCTCTCTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:19272627..19272651 22/25 Sense off-target LOC108716096 [provisional:alk]
chr1L:18823410..18823434 21/25 Sense off-target otop1.L
chr6L:43907432..43907456 21/25 Sense off-target znf385d.L
Scaffold32:1221136..1221160 22/25 unknown
chr1S:2807854..2807878 22/25 unknown
Scaffold65175:137..161 21/25 unknown
chr5S:129995510..129995534 21/25 unknown
chr7L:763191..763215 21/25 unknown
chr7S:86296510..86296534 21/25 unknown
chr9_10S:45334091..45334115 21/25 unknown
tropicalis 10.0 Chr1:91122268..91122292 22/25 Sense off-target kdm4b
Chr1:91127303..91127327 22/25 Sense off-target kdm4b
Chr1:158761507..158761531 22/25 Antisense off-target tmem132d
Chr1:158766518..158766542 22/25 Antisense off-target tmem132d
Chr1:185111360..185111384 22/25 Sense off-target pde8b
Chr3:34267724..34267748 22/25 Antisense off-target tenm2
Chr4:116710174..116710198 22/25 Antisense off-target LOC105947123
Chr2:107442567..107442591 22/25 Antisense off-target dmd.3
Chr2:58059470..58059494 22/25 Antisense off-target otc
Chr6:75022519..75022543 22/25 Sense off-target mocos
Chr6:75027587..75027611 22/25 Sense off-target mocos
Chr5:96034594..96034618 22/25 Sense off-target hmgcll1
Chr7:48638557..48638581 22/25 Sense off-target grid1
Chr7:48643622..48643646 22/25 Sense off-target grid1
Chr7:69592636..69592660 22/25 Antisense off-target snx19
Chr8:72904032..72904056 22/25 Antisense off-target hla-dqa1
Chr1:111161077..111161101 21/25 Antisense off-target b3gnt3.1
Chr4:140302874..140302898 21/25 Sense off-target prok2
Chr10:34397407..34397431 21/25 Antisense off-target cyp24a1
Chr2:129010750..129010774 21/25 Sense off-target pcdh9
Chr2:58064845..58064869 21/25 Antisense off-target otc
Chr2:87356407..87356431 21/25 Sense off-target adgrb2
Chr6:63613443..63613467 21/25 Antisense off-target LOC116411492
Chr5:4145962..4145986 21/25 Antisense off-target daam2
Chr5:60199029..60199053 21/25 Sense off-target LOC100496393
Chr8:10481012..10481036 21/25 Sense off-target ccdc180
Chr8:135923610..135923634 21/25 Sense off-target LOC100495695
Chr8:135923610..135923634 21/25 Antisense off-target LOC101735075
Chr8:79333680..79333704 21/25 Antisense off-target b9d2
Chr9:40547353..40547377 21/25 Antisense off-target nprl3
Chr9:44349807..44349831 21/25 Antisense off-target tmeff2
Chr1:190409284..190409308 22/25 unknown
Chr1:190414349..190414373 22/25 unknown
Chr1:67949670..67949694 22/25 unknown
Chr1:159574213..159574237 22/25 unknown
Chr2:116585490..116585514 22/25 unknown
Chr2:116590438..116590462 22/25 unknown
Chr6:1834232..1834256 22/25 unknown
Chr6:72530799..72530823 22/25 unknown
Chr6:72542280..72542304 22/25 unknown
Chr4:73718621..73718645 22/25 unknown
Chr5:109711143..109711167 22/25 unknown
Chr5:109715127..109715151 22/25 unknown
Chr5:138256451..138256475 22/25 unknown
Chr5:138261511..138261535 22/25 unknown
Chr5:138272683..138272707 22/25 unknown
Chr6:106214328..106214352 22/25 unknown
Chr6:106219391..106219415 22/25 unknown
Chr6:91398212..91398236 22/25 unknown
Chr6:91473960..91473984 22/25 unknown
Chr7:65419977..65420001 22/25 unknown
Chr1:203774153..203774177 21/25 unknown
Chr1:2313366..2313390 21/25 unknown
Chr1:88216626..88216650 21/25 unknown
Chr1:180726381..180726405 21/25 unknown
Chr1:180731428..180731452 21/25 unknown
Chr4:113223275..113223299 21/25 unknown
Chr4:45019821..45019845 21/25 unknown
Chr4:45024784..45024808 21/25 unknown
Chr4:45581563..45581587 21/25 unknown
Chr4:45745654..45745678 21/25 unknown
Chr2:115382670..115382694 21/25 unknown
Chr2:118838786..118838810 21/25 unknown
Chr2:88737486..88737510 21/25 unknown
Chr3:16690618..16690642 21/25 unknown
Chr6:1839283..1839307 21/25 unknown
Chr6:74531923..74531947 21/25 unknown
Chr5:60728482..60728506 21/25 unknown
Chr6:91402877..91402901 21/25 unknown
Chr7:11002743..11002767 21/25 unknown
Chr7:11006792..11006816 21/25 unknown
Chr7:55793461..55793485 21/25 unknown
Chr7:55799029..55799053 21/25 unknown
Chr7:59099695..59099719 21/25 unknown
Chr7:60863840..60863864 21/25 unknown
Chr7:65414911..65414935 21/25 unknown
Chr7:82611800..82611824 21/25 unknown
Chr8:143220078..143220102 21/25 unknown
Chr9:40485868..40485892 21/25 unknown
Chr9:44034698..44034722 21/25 unknown
Chr9:44039655..44039679 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers