Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311275

Morpholino Name: dmd.2 MO2
Synonyms: Dp427p1, TGas086e13, XtdysDp427p1.2
Target mRNA: dmd.2

Morpholino Type: uncategorized morpholino
Sequence: 5' CATACTGCATGTAGGCAGCCCGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7S:21776151..21776173 20/23 Antisense off-target slit1.S
chr9_10L:66971185..66971207 19/23 Antisense off-target pde11a.L
tropicalis 10.0 Chr8:87681839..87681861 19/23 Antisense off-target itpk1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers