Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311277

Morpholino Name: dmd.1 MO2
Synonyms: Dp71, TNeu143c03, XtdysDp71/40.2
Target mRNA: dmd.1

Morpholino Type: uncategorized morpholino
Sequence: 5' GGAATCGCTGCCTCTCTCTCTCCAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 21/25
genomic

MO
5' GGAGAGAGAGAGAAGCAGCGATTCC 3' |||||||||| ||||||||||| 3' GACCTCTCTCTCTCCGTCGCTAAGG 5' 5' GGAGAGAGAGAGAAGCAGCGATTCC 3' |||||||||| ||||||||||| 3' GACCTCTCTCTCTCCGTCGCTAAGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2L:106755113..106755137 21/25 Sense target dmd.1.L
chr2S:90660494..90660518 21/25 Sense target dmd.1.S
chr7L:90984833..90984857 21/25 Antisense off-target cep104.L
tropicalis 10.0 Chr2:108305455..108305479 25/25 Sense off-target dmd.3
Chr2:108305455..108305479 25/25 Sense off-target Xetrov107016617m.g
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers