Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311278

Morpholino Name: cdh3 MO2
Synonyms: E-Cad, TNeu073g23, XtE-cadherin
Target mRNA: cdh3

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTTTCCGAGCCTGGTGCCCCCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' ATGGGGGGCACCAGGCTCGGAAACC 3' ||||||||||||||||||||||||| 3' TACCCCCCGTGGTCCGAGCCTTTGG 5' 5' ATGGGGGGCACCAGGCTTAGAAACG 3' ||||||||||||||||| ||||| 3' TACCCCCCGTGGTCCGAGCCTTTGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4S:41974269..41974293 22/25 Antisense target cdh3.S
Scaffold176:44235..44259 21/25 unknown
tropicalis 10.0 Chr4:61526318..61526342 25/25 Antisense target cdh3
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers