Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311282

Morpholino Name: clint1 MO1
Synonyms: Enthoprotin, EpsinR, TEgg075k16, XtEpsinR
Target mRNA: clint1

Morpholino Type: uncategorized morpholino
Sequence: 5' CCGTACTTTCCACATGTTGAGCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' GATGCTCAACATGTGGAAAGTACGG 3' ||||||||||||||||||||||||| 3' CTACGAGTTGTACACCTTTCATGCC 5' 5' GATGCTCAACATGTGGAAAGTGCGG 3' ||||||||||||||||||||| ||| 3' CTACGAGTTGTACACCTTTCATGCC 5' 5' GATGCTCAACATGTGGAAAGTGCGG 3' ||||||||||||||||||||| ||| 3' CTACGAGTTGTACACCTTTCATGCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:5975469..5975493 24/25 Antisense target clint1.L
chr3S:10502860..10502884 24/25 Antisense target clint1.S
chr5L:116619252..116619276 22/25 unknown
tropicalis 10.0 Chr3:13943726..13943750 25/25 Antisense target clint1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers