Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311283

Morpholino Name: loc733728 MO1
Synonyms: TEgg055b18, XtETGF
Target mRNA: XB5893022 [provisional]

Morpholino Type: uncategorized morpholino
Sequence: 5' GTTTAACATCGCACAAATGGAACCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6S:83485817..83485841 21/25 Sense off-target impa2.S
tropicalis 10.0 Chr7:47518524..47518548 24/25 Antisense off-target LOC733728
Chr6:103842828..103842852 21/25 Sense off-target impa2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers