Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311284

Morpholino Name: ext1 MO2
Synonyms: Exostosin 1, TEgg033o10, XtExostosin-1
Target mRNA: ext1

Morpholino Type: uncategorized morpholino
Sequence: 5' TGCATGTGTCCGGTCAGGGTGCTAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25
genomic

MO
5' CGAGCACCCTGACCGGACACATGCA 3' | ||||||||||||||||||||||| 3' GATCGTGGGACTGGCCTGTGTACGT 5' 5' CGAGCACCCTGACCGGACACATGCA 3' | ||||||||||||||||||||||| 3' GATCGTGGGACTGGCCTGTGTACGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6S:114768412..114768436 24/25 Antisense target ext1.S
chr6L:139028176..139028200 23/25 unknown
tropicalis 10.0 Chr6:137307247..137307271 24/25 Antisense target ext1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers