Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311286

Morpholino Name: fgfr3 MO1
Synonyms: TGas092f08, XtFgfr3-1, cek2
Target mRNA: fgfr3

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGCCTTAGACATCCTCTGGTCGCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' TGCGACCAGAGGATGTCTAAGGCTG 3' ||||||||||||||||||||||||| 3' ACGCTGGTCTCCTACAGATTCCGAC 5' 5' TGCGACTAGAGGATGTCTAAGGCTG 3' |||||| |||||||||||||||||| 3' ACGCTGGTCTCCTACAGATTCCGAC 5' 5' TGCGACTAGAGGATGTCTAAGGCTG 3' |||||| |||||||||||||||||| 3' ACGCTGGTCTCCTACAGATTCCGAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:12866115..12866139 24/25 Antisense target fgfr3.L
chr1S:12021904..12021928 24/25 Antisense target fgfr3.S
tropicalis 10.0 Chr1:20846489..20846513 25/25 Antisense target fgfr3
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers