Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311288

Morpholino Name: fgfr4 MO5
Synonyms: TEgg061a19, XtFgfr4a-1
Target mRNA: fgfr4

Morpholino Type: uncategorized morpholino
Sequence: 5' GGCTCCCCATTCATAAGAAGTCCGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' GCGGACTTCTTATGAATGGGGAGCC 3' ||||||||||||||||||||||||| 3' CGCCTGAAGAATACTTACCCCTCGG 5' 5' GTGGACTTCTTATGAATGGGGAGAG 3' | ||||||||||||||||||||| 3' CGCCTGAAGAATACTTACCCCTCGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3S:98891680..98891704 22/25 Antisense target fgfr4.S
chr3L:5021009..5021033 22/25 Antisense off-target ovch1.L
tropicalis 10.0 Chr3:46332713..46332737 25/25 Antisense target fgfr4
Chr1:166142585..166142609 21/25 Sense off-target kremen1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers