Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311291

Morpholino Name: celsr1 MO2
Synonyms: Flamingo1, TGas128m18, Xtflamingo1/2.2
Target mRNA: celsr1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCGCTCGCCCCAACTTGACTTCTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 23/25
genomic

MO
5' AAGAAGTCAAGTTGGGGCGAGCGGC 3' ||||||||||||||||||||||||| 3' TTCTTCAGTTCAACCCCGCTCGCCG 5' 5' AAGAAGTCAAGTTGGGGCGAGTGGC 3' ||||||||||||||||||||| ||| 3' TTCTTCAGTTCAACCCCGCTCGCCG 5' 5' AAGAAGTGAAATTGGGGCGAGCGGC 3' ||||||| || |||||||||||||| 3' TTCTTCAGTTCAACCCCGCTCGCCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:65648444..65648468 24/25 Antisense target celsr1.L
chr3S:73322469..73322493 23/25 Antisense target celsr1.S
tropicalis 10.0 Chr3:74488943..74488967 25/25 Antisense target celsr1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers